Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250598

Morpholino Name: wdr5 MO2
Synonyms: WDR5 mRNAs, wdr5, xWDR5
mRNA Target: wdr5

Morpholino Type:
Sequence:
5' CATGGTGTCAGCACTAGAATGGTGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' GCACCATTCTAGTGCTGACACCATG 3' ||||||||||||||||||||||||| 3' CGTGGTAAGATCACGACTGTGGTAC 5' 5' GCACCATTCTAGTGCTTACACCATG 3' |||||||||||||||| |||||||| 3' CGTGGTAAGATCACGACTGTGGTAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold255149:311408-311432 25/25 Antisense target wdr5.L
Scaffold251007:201082-201106 24/25 Antisense target wdr5.S
tropicalis 7.1 scaffold_2:111226861-111226885 21/25 unknown
scaffold_5:22775037-22775061 21/25 Antisense off-target tsc22d2
Publications
First: WDR5 associates with histone H3 methylated at K4 and is essential for H3 K4 methylation and vertebrate development. [Cell 2005]
Most recent: A developmental requirement for HIRA-dependent H3.3 deposition revealed at gastrulation in Xenopus. [Cell Rep 2012]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556