Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250598

Morpholino Name: wdr5 MO2
Synonyms: WDR5 mRNAs, wdr5, xWDR5
Target mRNA: wdr5

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CATGGTGTCAGCACTAGAATGGTGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' GCACCATTCTAGTGCTGACACCATG 3' ||||||||||||||||||||||||| 3' CGTGGTAAGATCACGACTGTGGTAC 5' 5' GCACCATTCTAGTGCTTACACCATG 3' |||||||||||||||| |||||||| 3' CGTGGTAAGATCACGACTGTGGTAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:5469117..5469141 25/25 Antisense target wdr5.L
chr8S:30232128..30232152 24/25 Antisense target wdr5.S
tropicalis 10.0 Chr5:118448538..118448562 21/25 Antisense off-target tsc22d2
Chr2:21722004..21722028 21/25 unknown
Publications
First: WDR5 associates with histone H3 methylated at K4 and is essential for H3 K4 methylation and vertebrate development., Cell 2005    
Most recent: A developmental requirement for HIRA-dependent H3.3 deposition revealed at gastrulation in Xenopus., Cell Rep 2012                                        
View All Papers