Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250602

Morpholino Name: wls MO1
Synonyms: Xwntless
mRNA Target: wls

Morpholino Type: uncategorized morpholino
Sequence:
5' AATGATAGCCCCAGCCATACTGTAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' ATACAGTATGGCTGGGGCTATCATT 3' ||||||||||||||||||||||||| 3' TATGTCATACCGACCCCGATAGTAA 5' 5' ATACAGTATGGCTGGGGCTATCATT 3' ||||||||||||||||||||||||| 3' TATGTCATACCGACCCCGATAGTAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:72724250..72724274 25/25 Antisense target wls.L
chr4S:57859961..57859985 25/25 Antisense target wls.S
chr6L:141185235..141185259 22/25 unknown
chr1L:103090902..103090926 21/25 Sense off-target LOC108713200 [provisional:hcn2]
chr1S:79090439..79090463 21/25 Antisense off-target ebi3.S
chr4L:134299524..134299548 21/25 unknown
chr8L:108963950..108963974 21/25 Sense off-target crabp2.L
chr8L:108963950..108963974 21/25 Sense off-target rhbg.L
chr8S:92947535..92947559 21/25 Sense off-target rhbg.S
chr9_10L:100704643..100704667 21/25 Sense off-target otoa.L
tropicalis 10.0 Chr6:12080689..12080713 21/25 unknown
Chr6:12110656..12110680 21/25 unknown
Chr6:11999176..11999200 21/25 unknown
Chr6:12016886..12016910 21/25 Antisense off-target Xetrov107041331m.g
Chr6:12057189..12057213 21/25 Antisense off-target Xetrov107041332m.g
Publications
First: Xenopus Wntless and the retromer complex cooperate to regulate XWnt4 secretion., Mol Cell Biol 2009    
Most recent:
View All Papers