Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250602

Morpholino Name: wls MO1
Synonyms: Xwntless
mRNA Target: wls

Morpholino Type: uncategorized morpholino
Sequence:
5' AATGATAGCCCCAGCCATACTGTAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATACAGTATGGCTGGGGCTATCATT 3' ||||||||||||||||||||||||| 3' TATGTCATACCGACCCCGATAGTAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold155039:226372..226396 25/25 Antisense target wls.L
Scaffold275988:645421..645445 25/25 Antisense off-target Xelaev16037940m
Scaffold220448:1143438..1143462 22/25 unknown
Scaffold13523:3247657..3247681 21/25 unknown
Scaffold183165:84616..84640 21/25 Sense off-target otoa.L
Scaffold26819:2250706..2250730 21/25 Sense off-target rhbg.L
Scaffold41091:3123094..3123118 21/25 unknown
Scaffold46215:2620421..2620445 21/25 Sense off-target Xelaev16056051m
Scaffold56125:891446..891470 21/25 Antisense off-target ebi3.S
tropicalis 7.1 scaffold_6:134073414..134073438 21/25 unknown
scaffold_6:134100959..134100983 21/25 unknown
scaffold_6:134127667..134127691 21/25 unknown
scaffold_6:134184199..134184223 21/25 unknown
Publications
First: Xenopus Wntless and the retromer complex cooperate to regulate XWnt4 secretion., Mol Cell Biol 2009    
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556