Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250604

Morpholino Name: wnt1 MO1
Synonyms: Wnt1MO
Target mRNA: wnt1

Morpholino Type: uncategorized morpholino
Sequence: 5' ATCCTCATTGCTTTGGAGACAAGAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 21/25
genomic

MO
5' ATCTTGTCTCCAAAGCAATGAGGAT 3' ||||||||||||||||||||||||| 3' TAGAACAGAGGTTTCGTTACTCCTA 5' 5' CGCTTCTCTCCAGAGCAATGAGGAT 3' ||| |||||| |||||||||||| 3' TAGAACAGAGGTTTCGTTACTCCTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2L:136839372..136839396 25/25 Antisense target wnt1.L
chr2S:118709861..118709885 21/25 Antisense target wnt1.S
chr3L:44135791..44135815 23/25 Sense off-target LOC108711038 [provisional:dnah3]
chr9_10S:38903544..38903568 21/25 Antisense off-target gas7.S
Publications
First: Hindbrain-derived Wnt and Fgf signals cooperate to specify the otic placode in Xenopus., Dev Biol 2008        
Most recent:
View All Papers