Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250605

Morpholino Name: wnt11 MO1
Synonyms: WntR MO1, wnt11, wnt11r MO
mRNA Target: wnt11

Morpholino Type: uncategorized morpholino
Sequence:
5' CTTCATCTTCAAAACCCAATAACAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' TTGTTATTGGGGTTTAAAGATGAAG 3' ||||||||||| ||| ||||||||| 3' AACAATAACCCAAAACTTCTACTTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold273574:79..103 25/25 unknown
Scaffold68908:1428124..1428148 25/25 Antisense off-target Xelaev16068618m
Scaffold91476:497225..497249 25/25 unknown
Scaffold152894:2556630..2556654 22/25 unknown
Scaffold245981:93..117 22/25 unknown
Scaffold237598:1660769..1660793 21/25 unknown
Scaffold245044:7576313..7576337 21/25 Sense off-target Xelaev16032831m
Scaffold394435:30079..30103 21/25 unknown
Scaffold43791:1885506..1885530 21/25 unknown
Scaffold84188:762799..762823 21/25 unknown
tropicalis 7.1 scaffold_2:140079551..140079575 23/25 Antisense target wnt11
scaffold_7:62297070..62297094 22/25 Antisense off-target exosc10
Publications
First: Wnt11-R, a protein closely related to mammalian Wnt11, is required for heart morphogenesis in Xenopus., Dev Biol 2005            
Most recent: The CapZ interacting protein Rcsd1 is required for cardiogenesis downstream of Wnt11a in Xenopus laevis., Dev Biol 2017                                    
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556