Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250606

Morpholino Name: wnt11 MO2
Synonyms: WntR MO2
mRNA Target: wnt11

Morpholino Type: uncategorized morpholino
Sequence:
5' ACTGTATCCAAAGAGAGTTCCGAGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25
genomic

MO
5' CCTTGGAACTCTCTTTGGATAACGT 3' ||| ||||||||||||||||| || 3' GGAGCCTTGAGAGAAACCTATGTCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold91476:497173..497197 25/25 unknown
Scaffold68908:1428187..1428211 22/25 Antisense off-target Xelaev16068618m
tropicalis 7.1 scaffold_2:140079474..140079498 22/25 Antisense target wnt11
scaffold_8:25313968..25313992 21/25 unknown
scaffold_8:25314092..25314116 21/25 unknown
Publications
First: Neural crest specification by noncanonical Wnt signaling and PAR-1., Development 2011                          
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556