Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250607

Morpholino Name: wnt11b MO1
Synonyms: Wnt-11 MO, Wnt11, Wnt11-MO, XWnt-11 MO, XWnt-11 morpholino, wnt11 MO, wnt11-2ome, wnt11b
mRNA Target: wnt11b

Morpholino Type: uncategorized morpholino
Sequence:
5' CCAGTGACGGGTCGGAGCCATTGGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25 25/25
genomic

MO
5' ACCAATGGCTCTAATCCGTCACTGT 3' ||||||||||| | ||||||||| 3' TGGTTACCGAGGCTGGGCAGTGACC 5' 5' ACCAATGGCTCCGACCCGTCACTGG 3' ||||||||||||||||||||||||| 3' TGGTTACCGAGGCTGGGCAGTGACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold36991:2155227..2155251 25/25 Antisense target wnt11b.L
tropicalis 7.1 scaffold_8:24216940..24216964 21/25 Antisense target wnt11b
Publications
First: Wnt-11 activation of a non-canonical Wnt signalling pathway is required for cardiogenesis., Nature 2002  
Most recent: Formation of a "Pre-mouth Array" from the Extreme Anterior Domain Is Directed by Neural Crest and Wnt/PCP Signaling., Cell Rep 2016              
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556