Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250609

Morpholino Name: wnt2 MO1
Synonyms:
mRNA Target: wnt2

Morpholino Type:
Sequence:
5' ATGAGGAGGTAACAACAGCTCCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGGGAGCTGTTGTTACCTCCTCAT 3' ||||||||||||||||||||||||| 3' TACCCTCGACAACAATGGAGGAGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold26505:30947-30971 25/25 Antisense off-target Xelaev16035497m
Scaffold152894:3263095-3263119 24/25 Antisense off-target Xelaev16015356m
Scaffold103418:362647-362671 21/25 Sense off-target Xelaev16001046m
Scaffold9994:12504944-12504968 21/25 unknown
tropicalis 7.1 scaffold_3:96901338-96901362 25/25 Antisense target wnt2
Publications
First: Suppression of Bmp4 signaling by the zinc-finger repressors Osr1 and Osr2 is required for Wnt/β-catenin-mediated lung specification in Xenopus. [Development 2012]
Most recent: A Molecular atlas of Xenopus respiratory system development. [Dev Dyn 2015]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556