Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250609

Morpholino Name: wnt2 MO1
Synonyms:
Target mRNA: wnt2

Morpholino Type: uncategorized morpholino
Sequence: 5' ATGAGGAGGTAACAACAGCTCCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' ATGGGAGCTGTTGTTACCTCCTCAT 3' ||||||||||||||||||||||||| 3' TACCCTCGACAACAATGGAGGAGTA 5' 5' ATGGGAGCTGTTGTTACCTCCTCAT 3' ||||||||||||||||||||||||| 3' TACCCTCGACAACAATGGAGGAGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:59725909..59725933 25/25 Antisense target wnt2.L
chr3S:78523301..78523325 24/25 Antisense off-target LOC108713107 [provisional:wnt2]
chr1L:83124409..83124433 21/25 unknown
chr9_10L:100296866..100296890 21/25 unknown
tropicalis 10.0 Chr3:68409356..68409380 25/25 Antisense target wnt2
Chr7:125429574..125429598 21/25 Antisense off-target LOC101731739
Publications
First: Suppression of Bmp4 signaling by the zinc-finger repressors Osr1 and Osr2 is required for Wnt/β-catenin-mediated lung specification in Xenopus., Development 2012                                                                                  
Most recent: A Molecular atlas of Xenopus respiratory system development., Dev Dyn 2015                      
View All Papers