Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250614

Morpholino Name: wnt3a MO1
Synonyms: Wnt3a MO, Wnt3a translational blocking, translational blocking
mRNA Target: wnt3a

Morpholino Type: uncategorized morpholino
Sequence:
5' GAGCAAATATCCAAAGCAGCCCATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold94859:85423..85447 24/25 Antisense off-target wnt3a.L
Scaffold1187:5189710..5189734 21/25 Antisense off-target Xelaev16004876m
Scaffold58994:248048..248072 21/25 Sense off-target Xelaev16064516m
tropicalis 7.1 scaffold_6:138089017..138089041 23/25 unknown
scaffold_3:9851211..9851235 21/25 unknown
scaffold_9:30102094..30102118 21/25 Antisense off-target ppp2r3a
Publications
First: Mesodermal Wnt signaling organizes the neural plate via Meis3., Development 2010          
Most recent: A hindbrain-repressive Wnt3a/Meis3/Tsh1 circuit promotes neuronal differentiation and coordinates tissue maturation., Development 2012                      
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556