Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250615

Morpholino Name: wnt3a MO2
Synonyms: Wnt3a MO, Wnt3a intron-exon
mRNA Target: wnt3a

Morpholino Type: uncategorized morpholino
Sequence:
5' TCTAAGATCGACTGGAAACAAAATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CATTTTGTTTCCAGTCGATCTTAGA 3' ||||||||||||||||||||||||| 3' GTAAAACAAAGGTCAGCTAGAATCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold30080:386385..386409 22/25 Antisense off-target Xelaev16040497m
Scaffold33104:752396..752420 21/25 Antisense off-target alg10.S
Scaffold98463:1369537..1369561 21/25 unknown
tropicalis 7.1 scaffold_6:138147759..138147783 25/25 Antisense target wnt3a
Publications
First: Mesodermal Wnt signaling organizes the neural plate via Meis3., Development 2010          
Most recent: A hindbrain-repressive Wnt3a/Meis3/Tsh1 circuit promotes neuronal differentiation and coordinates tissue maturation., Development 2012                      
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556