Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250616

Morpholino Name: wnt3a MO3
Synonyms: Wnt3a MO, Wnt3a exon-intron, exon-intron
mRNA Target: wnt3a

Morpholino Type: uncategorized morpholino
Sequence:
5' AGAAAAGTAACTTACTGTTCTGCCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' CGGCAGAACAGTAAGTTACTTTTCT 3' |||||||||||||||||||||||| 3' TCCGTCTTGTCATTCAATGAAAAGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold70222:531171..531195 22/25 unknown
Scaffold112411:1852721..1852745 21/25 Antisense off-target Xelaev16003281m
Scaffold16807:4560235..4560259 21/25 unknown
Scaffold234771:1816949..1816973 21/25 unknown
Scaffold25254:4555987..4556011 21/25 Antisense off-target rad9b.L
Scaffold61609:61166..61190 21/25 unknown
Scaffold94859:33944..33968 21/25 Antisense off-target wnt3a.L
tropicalis 7.1 scaffold_6:138144451..138144475 24/25 Antisense target wnt3a
scaffold_1:160396214..160396238 22/25 unknown
scaffold_2:15539653..15539677 22/25 Sense off-target tbx2
scaffold_1:60712622..60712646 21/25 Antisense off-target trpv4
scaffold_1:75665300..75665324 21/25 Sense off-target nav1
scaffold_2:82023038..82023062 21/25 unknown
scaffold_6:43094306..43094330 21/25 Antisense off-target tgif1
Publications
First: Mesodermal Wnt signaling organizes the neural plate via Meis3., Development 2010          
Most recent: A hindbrain-repressive Wnt3a/Meis3/Tsh1 circuit promotes neuronal differentiation and coordinates tissue maturation., Development 2012                      
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556