Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250617

Morpholino Name: wnt4 MO1
Synonyms: Wnt-4 MO, Wnt4-MO, wnt4 MO
Target mRNA: wnt4

Morpholino Type: uncategorized morpholino
Sequence: 5' GTACTCTGGGGTCATCCTGCTGCTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/25 25/25 24/25
genomic

MO
5' TCCCAGCAGGATGACCCCAGAATAC 3' |||||||||||||||||| ||| 3' GTCGTCGTCCTACTGGGGTCTCATG 5' 5' CAGCAGCAGGATGACCCCAGAGTAC 3' ||||||||||||||||||||||||| 3' GTCGTCGTCCTACTGGGGTCTCATG 5' 5' CAGCAGCAGGATGACCCCTGAGTAC 3' |||||||||||||||||| |||||| 3' GTCGTCGTCCTACTGGGGTCTCATG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr7L:88329423..88329447 25/25 Antisense target wnt4.L
chr7S:63297250..63297274 24/25 Antisense target wnt4.S
chr2L:108390019..108390043 21/25 Sense off-target tmtops2.L
chr8L:7188142..7188166 21/25 Sense off-target LOC108698217
Scaffold107159:151..175 21/25 unknown
chr6L:36336956..36336980 21/25 unknown
tropicalis 10.0 Chr7:94266546..94266570 21/25 Antisense target wnt4
Chr1:168086064..168086088 22/25 Antisense off-target c5orf63
Chr7:124465169..124465193 22/25 Sense off-target dyrk1a.2
Publications
First: Essential function of Wnt-4 for tubulogenesis in the Xenopus pronephric kidney., Dev Biol 2002                      
Most recent: Pescadillo homologue 1 and Peter Pan function during Xenopus laevis pronephros development., Biol Cell 2011  
View All Papers