Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250618

Morpholino Name: wnt5a MO1
Synonyms: Wnt5a, XWnt-5A MO
mRNA Target: wnt5a

Morpholino Type: uncategorized morpholino
Sequence:
5' GGTGCAACCAGGGCACAATTACTTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AAAGTAATTGTGCCCTGGTTGCACC 3' ||||||||||||||||||||||||| 3' TTTCATTAACACGGGACCAACGTGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 Scaffold40:720812..720836 25/25 Antisense target wnt5a.S
chr5L:143092899..143092923 21/25 unknown
Publications
First: Wnt-5A/Ror2 regulate expression of XPAPC through an alternative noncanonical signaling pathway., Dev Cell 2007      
Most recent: Regulation of distinct branches of the non-canonical Wnt-signaling network in Xenopus dorsal marginal zone explants., BMC Biol 2016                  
View All Papers