Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250622

Morpholino Name: wnt8a MO1
Synonyms: W8MO, Wnt8, Wnt8 MO, Wnt8MO, Xwnt8
mRNA Target: wnt8a

Morpholino Type: uncategorized morpholino
Sequence:
5' AAAGTGGTGTTTTGCATGATGAAGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25
genomic

MO
5' TCTCCATCATGAAGAACACCACTTT 3' || ||||||| | ||||||||||| 3' GGAAGTAGTACGTTTTGTGGTGAAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold140825:490773..490797 25/25 unknown
Scaffold44494:4806581..4806605 22/25 Antisense off-target rbp1.L
Scaffold102974:8006711..8006735 21/25 unknown
Scaffold12518:11014199..11014223 21/25 Antisense off-target Xelaev16007332m
Scaffold238904:574..598 21/25 unknown
Scaffold32212:8678535..8678559 21/25 Antisense off-target Xelaev16042915m
tropicalis 7.1 scaffold_2:69490631..69490655 22/25 unknown
scaffold_1:181774195..181774219 21/25 unknown
scaffold_3:54139362..54139386 21/25 unknown
scaffold_3:59376142..59376166 21/25 Antisense target wnt8a
scaffold_4:23471170..23471194 21/25 unknown
scaffold_7:48369414..48369438 21/25 unknown
Publications
First: FGF8, Wnt8 and Myf5 are target genes of Tbx6 during anteroposterior specification in Xenopus embryo., Dev Biol 2006                      
Most recent: Dkk2 promotes neural crest specification by activating Wnt/β-catenin signaling in a GSK3β independent manner., Elife 2018                        
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556