Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250624

Morpholino Name: wnt8a MO3
Synonyms: Xwnt-8 MO, Xwnt8 MO
mRNA Target: wnt8a

Morpholino Type: uncategorized morpholino
Sequence:
5' GAACAAAGTGGTGTTTTGCATGATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25
genomic

MO
5' CATCATGAAGAACACCACTTTGTTT 3' ||||||| | |||||||||||||| 3' GTAGTACGTTTTGTGGTGAAACAAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold140825:490769..490793 25/25 unknown
Scaffold102974:10060657..10060681 21/25 Antisense off-target Xelaev16000749m
Scaffold12879:1759551..1759575 21/25 Sense off-target snx2.S
Scaffold32212:8678531..8678555 21/25 Antisense off-target Xelaev16042915m
Scaffold52573:2475203..2475227 21/25 unknown
tropicalis 7.1 scaffold_3:59376138..59376162 22/25 Antisense target wnt8a
Publications
First: Embryonic dorsal-ventral signaling: secreted frizzled-related proteins as inhibitors of tolloid proteinases., Cell 2006          
Most recent: Roles of two types of heparan sulfate clusters in Wnt distribution and signaling in Xenopus., Nat Commun 2017                                                    
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556