Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250625

Morpholino Name: wnt8a MO4
Synonyms: wnt8
mRNA Target: wnt8a

Morpholino Type: uncategorized morpholino
Sequence:
5' ACGCAAAAATCTGGCAAGGGTTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold42960:1863790..1863814 22/25 unknown
Scaffold120511:1464816..1464840 21/25 Antisense off-target Xelaev16005877m
Scaffold12933:4471217..4471241 21/25 Sense off-target wdr46.S
Scaffold50694:5179233..5179257 21/25 Antisense off-target atp11c.S
Scaffold86871:2518588..2518612 21/25 Sense off-target Xelaev16076693m
Scaffold98502:815858..815882 21/25 unknown
tropicalis 7.1 scaffold_5:76014120..76014144 22/25 Sense off-target cnksr3
Publications
First: Wnt8 is required in lateral mesendodermal precursors for neural posteriorization in vivo., Development 2001  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556