Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250626

Morpholino Name: wt1 MO1
Synonyms: wt1-MO1
Target mRNA: wt1

Morpholino Type: uncategorized morpholino
Sequence: 5' ATTCATATCCCGCACATCAGATCCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 25/25 23/25
genomic

MO
5' GGGGTCTGATGTCCGGGATATGAAC 3' ||| |||||||| ||||||||||| 3' CCCTAGACTACACGCCCTATACTTA 5' 5' GGGATCTGATGTGCGGGATATGAAT 3' ||||||||||||||||||||||||| 3' CCCTAGACTACACGCCCTATACTTA 5' 5' GGGGTCTGATGTCCGGGATATGAAT 3' ||| |||||||| |||||||||||| 3' CCCTAGACTACACGCCCTATACTTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:13096722..13096746 25/25 Antisense target wt1.L
chr4S:10122315..10122339 23/25 Antisense target wt1.S
chr7L:50524834..50524858 23/25 Sense off-target Xelaev18035022m
tropicalis 10.0 Chr4:18823572..18823596 22/25 Antisense target wt1
Chr3:112038309..112038333 21/25 unknown
Publications
First: Notch signaling, wt1 and foxc2 are key regulators of the podocyte gene regulatory network in Xenopus., Development 2010                              
Most recent:
View All Papers