Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250628

Morpholino Name: wt1 MO3
Synonyms: wt1-MO2, xWT1a MO
Target mRNA: wt1

Morpholino Type: uncategorized morpholino
Sequence: 5' CATATCCCGGACATCAGACCCCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' GATGGGGTCTGATGTCCGGGATATG 3' ||||||||||||||||||||||||| 3' CTACCCCAGACTACAGGCCCTATAC 5' 5' GATGGGGTCTGATGTCCGGGATATG 3' ||||||||||||||||||||||||| 3' CTACCCCAGACTACAGGCCCTATAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4S:10122318..10122342 25/25 Antisense target wt1.S
chr7L:50524831..50524855 25/25 Sense off-target Xelaev18035022m
tropicalis 10.0 Chr4:18823569..18823593 25/25 Antisense target wt1
Publications
First: The Notch-effector HRT1 gene plays a role in glomerular development and patterning of the Xenopus pronephros anlagen., Development 2006                    
Most recent: Notch signaling, wt1 and foxc2 are key regulators of the podocyte gene regulatory network in Xenopus., Development 2010                              
View All Papers