Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250629

Morpholino Name: wt1 MO4
Synonyms: wt1 MO
Target mRNA: wt1

Morpholino Type: uncategorized morpholino
Sequence: 5' CATCTGAAAGCTCAGCCGGCTGCTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' GAGCAGCCCGCTGAGCTTTCCGATG 3' |||||||| ||||||||||| |||| 3' CTCGTCGGCCGACTCGAAAGTCTAC 5' 5' GAGCAGCCGGCTGAGCTTTCAGATG 3' ||||||||||||||||||||||||| 3' CTCGTCGGCCGACTCGAAAGTCTAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:13096698..13096722 25/25 Antisense target wt1.L
chr5L:33850394..33850418 21/25 unknown
tropicalis 10.0 Chr4:18823548..18823572 23/25 Antisense target wt1
Publications
First: WT1 and Sox11 regulate synergistically the promoter of the Wnt4 gene that encodes a critical signal for nephrogenesis., Exp Cell Res 2012  
Most recent:
View All Papers