Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250631

Morpholino Name: xbp1 MO1
Synonyms: MOxXBP
mRNA Target: xbp1

Morpholino Type:
Sequence:
5' GCTCCCACGACCACCATGTTGAAGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' CCTTGGACATGGTGGTCGTGGGAGC 3' |||| ||||||||||||||||||| 3' GGAAGTTGTACCACCAGCACCCTCG 5' 5' CCTTCAACATGGTGGTCGTGGGAGC 3' ||||||||||||||||||||||||| 3' GGAAGTTGTACCACCAGCACCCTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold25254:742064-742088 25/25 Antisense target xbp1.L
Scaffold179290:839701-839725 22/25 Antisense off-target Xelaev16021711m
Scaffold40738:49574-49598 21/25 unknown
tropicalis 7.1 scaffold_1:124799448-124799472 23/25 Sense off-target caps
scaffold_1:42775497-42775521 23/25 Antisense target xbp1
Publications
First: XBP1 forms a regulatory loop with BMP-4 and suppresses mesodermal and neural differentiation in Xenopus embryos. [Mech Dev 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556