Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250632

Morpholino Name: xbp1 MO2
Synonyms: XBP1(C)MO, xbp1 MO
mRNA Target: xbp1

Morpholino Type:
Sequence:
5' GACATCTGGGCCTGCTCCTGCTGCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' TGCAGCAGGAGCAGGCCCAGATGTC 3' ||||||||||||||||||||||||| 3' ACGTCGTCCTCGTCCGGGTCTACAG 5' 5' TGCAGCAGGAGCAGGCCCAGATGTC 3' ||||||||||||||||||||||||| 3' ACGTCGTCCTCGTCCGGGTCTACAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold179290:831310-831334 25/25 Antisense off-target Xelaev16021711m
Scaffold25254:734227-734251 25/25 Antisense target xbp1.L
Scaffold285865:798718-798742 21/25 unknown
Scaffold56777:5826596-5826620 21/25 Sense off-target Xelaev16062687m
tropicalis 7.1 scaffold_1:42783340-42783364 25/25 Antisense target xbp1
scaffold_1:69676056-69676080 21/25 unknown
Publications
First: Coordinated activation of the secretory pathway during notochord formation in the Xenopus embryo. [Development 2009]
Most recent: IRE1α knockdown rescues tunicamycin-induced developmental defects and apoptosis in Xenopus laevis. [J Biomed Res 2014]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556