Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250633

Morpholino Name: xbp1 MO3
Synonyms: xbp1 ( n ) MO
mRNA Target: xbp1

Morpholino Type:
Sequence:
5' GCCCAACAAGAGATCAGACTCAGAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25 22/25
genomic

MO
5' TTTACAGTCTGATCTCTTGTTGGGC 3' | |||||||||||||||||||| 3' GAGACTCAGACTAGAGAACAACCCG 5' 5' CTTACAGTCTGATCTCTTGTTGGGC 3' || |||||||||||||||||||| 3' GAGACTCAGACTAGAGAACAACCCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold179290:830040-830064 22/25 Antisense off-target Xelaev16021711m
Scaffold25254:732791-732815 22/25 Antisense target xbp1.L
Scaffold9266:6718565-6718589 21/25 unknown
tropicalis 7.1 scaffold_1:42783415-42783432 25/25 Antisense target xbp1
scaffold_1:42785001-42785025 21/25 Antisense target xbp1
Publications
First: Coordinated activation of the secretory pathway during notochord formation in the Xenopus embryo. [Development 2009]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556