Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250634

Morpholino Name: xbp1 MO4
Synonyms: XBPcytoMO
mRNA Target: xbp1

Morpholino Type:
Sequence:
5' ACATCTGGGCCTGCTCCTGCTGCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/24 24/24
genomic

MO
5' TGCAGCAGGAGCAGGCCCAGATGT 3' |||||||||||||||||||||||| 3' ACGTCGTCCTCGTCCGGGTCTACA 5' 5' TGCAGCAGGAGCAGGCCCAGATGT 3' |||||||||||||||||||||||| 3' ACGTCGTCCTCGTCCGGGTCTACA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold179290:831311-831334 24/24 Antisense off-target Xelaev16021711m
Scaffold25254:734228-734251 24/24 Antisense target xbp1.L
Scaffold285865:798718-798741 21/24 unknown
Scaffold56777:5826596-5826619 21/24 Sense off-target Xelaev16062687m
Scaffold11199:4545502-4545525 20/24 unknown
Scaffold210343:2213964-2213987 20/24 unknown
Scaffold267922:3443200-3443223 20/24 unknown
Scaffold315413:913146-913169 20/24 Sense off-target Xelaev16042248m
Scaffold84090:17755-17778 20/24 Sense off-target Xelaev16075772m
Scaffold98382:164113-164136 20/24 unknown
tropicalis 7.1 scaffold_1:42783340-42783363 24/24 Antisense target xbp1
scaffold_1:69676057-69676080 20/24 unknown
scaffold_1:73741873-73741896 20/24 unknown
scaffold_2:77981286-77981309 20/24 Antisense off-target kmt2d
scaffold_2:77981376-77981399 20/24 Antisense off-target kmt2d
Publications
First: IRE1beta is required for mesoderm formation in Xenopus embryos. [Mech Dev 2008]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556