Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250636

Morpholino Name: xiap MO2
Synonyms: XIAP MO#1
mRNA Target: xiap

Morpholino Type: uncategorized morpholino
Sequence:
5' GCATGTCATCTCCTCTTTAAATACG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CGTATTTAAAGAGGAGATGACATGC 3' ||||||||||||||||||||||||| 3' GCATAAATTTCTCCTCTACTGTACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:26882545..26882569 25/25 Antisense target xiap.L
chr1L:188939261..188939285 21/25 Antisense off-target ap3b1.L
chr9_10S:18522049..18522073 21/25 unknown
tropicalis 10.0 Chr2:84868811..84868835 21/25 unknown
Chr7:2665168..2665192 21/25 unknown
Publications
First: XIAP monoubiquitylates Groucho/TLE to promote canonical Wnt signaling., Mol Cell 2012    
Most recent:
View All Papers