Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250636

Morpholino Name: xiap MO2
Synonyms: XIAP MO#1
mRNA Target: xiap

Morpholino Type:
Sequence:
5' GCATGTCATCTCCTCTTTAAATACG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CGTATTTAAAGAGGAGATGACATGC 3' ||||||||||||||||||||||||| 3' GCATAAATTTCTCCTCTACTGTACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold7546:3504252-3504276 25/25 Antisense target xiap.L
Scaffold159815:983295-983319 21/25 unknown
Scaffold220499:1553387-1553411 21/25 Antisense off-target ap3b1.L
tropicalis 7.1 scaffold_2:8188345-8188369 21/25 unknown
scaffold_7:1964794-1964818 21/25 unknown
Publications
First: XIAP monoubiquitylates Groucho/TLE to promote canonical Wnt signaling. [Mol Cell 2012]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556