Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250637

Morpholino Name: xmc MO1
Synonyms: Anti-Xmc morpholino, xmc
mRNA Target: xmc

Morpholino Type: uncategorized morpholino
Sequence:
5' TGCAGCCATTATGTATATGTAAAAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:8892298..8892322 25/25 unknown
chr1L:206501786..206501810 22/25 Antisense off-target nars1.L
chr7S:24071975..24071999 22/25 unknown
Scaffold27:806876..806900 21/25 Antisense off-target LOC108704134
Scaffold27:806876..806900 21/25 Sense off-target ca10.S
Scaffold27:806876..806900 21/25 Antisense off-target LOC108704135
chr1S:101209367..101209391 21/25 Sense off-target nfia.S
chr1S:103016833..103016857 21/25 unknown
chr1S:115838466..115838490 21/25 unknown
chr3L:18628954..18628978 21/25 Antisense off-target LOC108710852 [provisional:atp10b]
chr3L:65972477..65972501 21/25 Antisense off-target Xelaev18017721m
chr4L:82572409..82572433 21/25 unknown
chr6L:61572579..61572603 21/25 Antisense off-target pou6f2.L
chr6S:37209383..37209407 21/25 unknown
chr8L:83301612..83301636 21/25 Sense off-target numbl.L
Scaffold27:806876..806900 21/25 Antisense off-target gps1.S
tropicalis 10.0 Chr5:61159184..61159208 22/25 unknown
Chr2:163728624..163728648 21/25 Sense off-target cntn5
Chr6:89169059..89169083 21/25 unknown
Chr7:101913099..101913123 21/25 Sense off-target prdm16
Chr7:37746956..37746980 21/25 unknown
Publications
First: Xenopus marginal coil (Xmc), a novel FGF inducible cytosolic coiled-coil protein regulating gastrulation movements., Mech Dev 2002              
Most recent:
View All Papers