Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250637

Morpholino Name: xmc MO1
Synonyms: Anti-Xmc morpholino, xmc
mRNA Target: xmc

Morpholino Type:
Sequence:
5' TGCAGCCATTATGTATATGTAAAAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold45452:1193879-1193903 25/25 Antisense off-target Xelaev16055131m
Scaffold26472:135348-135372 22/25 unknown
Scaffold52441:1732775-1732799 22/25 Antisense off-target nars.L
Scaffold114358:936371-936395 21/25 unknown
Scaffold15893:1539958-1539982 21/25 unknown
Scaffold185879:2912573-2912597 21/25 Sense off-target nfia.S
Scaffold19169:964139-964163 21/25 unknown
Scaffold276272:716326-716350 21/25 unknown
Scaffold289705:77-101 21/25 unknown
Scaffold3286:1245045-1245069 21/25 unknown
Scaffold360904:622-646 21/25 unknown
Scaffold78337:746997-747021 21/25 unknown
Scaffold91950:2616082-2616106 21/25 Sense off-target Xelaev16078554m
Scaffold98241:562081-562105 21/25 Sense off-target Xelaev16080434m
tropicalis 7.1 scaffold_74:101996-102020 22/25 unknown
scaffold_2:122263743-122263767 21/25 unknown
scaffold_4:21847301-21847325 21/25 unknown
scaffold_6:61245570-61245594 21/25 unknown
scaffold_7:33927362-33927386 21/25 unknown
scaffold_7:96881854-96881878 21/25 unknown
Publications
First: Xenopus marginal coil (Xmc), a novel FGF inducible cytosolic coiled-coil protein regulating gastrulation movements. [Mech Dev 2002]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556