Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250638

Morpholino Name: yap1 MO1
Synonyms: Xyap MO1
mRNA Target: yap1

Morpholino Type:
Sequence:
5' GGAGGTGGGAGCTAGGACAGCGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold6290:749386-749408 23/23 Antisense off-target Xelaev16066665m
Scaffold129653:9124-9146 21/23 unknown
Scaffold120511:686957-686979 20/23 unknown
Scaffold14978:10603614-10603636 20/23 Antisense off-target tdrd3.L
Scaffold15416:2128614-2128636 20/23 unknown
Scaffold159212:79101-79123 20/23 unknown
Scaffold23165:4967886-4967908 20/23 unknown
Scaffold51988:61393-61415 20/23 unknown
Scaffold52573:2994946-2994968 20/23 unknown
Scaffold143831:3502787-3502809 19/23 unknown
Scaffold197721:92387-92409 19/23 unknown
Scaffold4321:2775921-2775943 19/23 Antisense off-target Xelaev16052961m
Scaffold65414:948549-948571 19/23 unknown
Scaffold82102:4562142-4562164 19/23 unknown
Scaffold90041:5222067-5222089 19/23 unknown
Publications
First: Yes-associated protein 65 (YAP) expands neural progenitors and regulates Pax3 expression in the neural plate border zone. [PLoS One 2011]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556