Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250639

Morpholino Name: yap1 MO2
Synonyms: Xyap MO2
mRNA Target: yap1

Morpholino Type:
Sequence:
5' GGAGAGGACGCGGTAGGAGACTGTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold6290:749422..749446 25/25 Antisense off-target Xelaev16066665m
Scaffold334424:1278607..1278631 21/25 Antisense off-target Xelaev16044229m
Publications
First: Yes-associated protein 65 (YAP) expands neural progenitors and regulates Pax3 expression in the neural plate border zone. [PLoS One 2011]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556