Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250643

Morpholino Name: ywhab MO1
Synonyms: 14-3-3beta, TTpA010k20, Xt14-3-3beta
mRNA Target: ywhab

Morpholino Type:
Sequence:
5' CTGTACCAGTTCGCTCTTGTCCATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25 24/25
genomic

MO
5' CATGGACAAGAGCGAACTGGTACAG 3' ||||||||||||||||||||||||| 3' GTACCTGTTCTCGCTTGACCATGTC 5' 5' CATGGACAAGAGTGAACTGGTACAG 3' |||||||||||| |||||||||||| 3' GTACCTGTTCTCGCTTGACCATGTC 5' 5' CATGGACAAGAGTGAACTGGTACAG 3' |||||||||||| |||||||||||| 3' GTACCTGTTCTCGCTTGACCATGTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold13265:1231746-1231770 24/25 Antisense target ywhab.S
Scaffold75417:4119220-4119244 24/25 Antisense target ywhab.L
tropicalis 7.1 scaffold_10:28466941-28466965 25/25 Antisense target ywhab
scaffold_3b:3089170-3089194 21/25 unknown
scaffold_6:3537752-3537776 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556