Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250645

Morpholino Name: ywhab MO3
Synonyms: 14-3-3 beta
mRNA Target: ywhab

Morpholino Type:
Sequence:
5' TCTGTACCAGTTCACTCTTGTCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genomic

MO
5' ATGGACAAGAGCGAACTGGTACAGA 3' ||||||||||| ||||||||||||| 3' TACCTGTTCTCACTTGACCATGTCT 5' 5' ATGGACAAGAGTGAACTGGTACAGA 3' ||||||||||||||||||||||||| 3' TACCTGTTCTCACTTGACCATGTCT 5' 5' ATGGACAAGAGTGAACTGGTACAGA 3' ||||||||||||||||||||||||| 3' TACCTGTTCTCACTTGACCATGTCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold13265:1231745..1231769 25/25 Antisense target ywhab.S
Scaffold75417:4119219..4119243 25/25 Antisense target ywhab.L
Scaffold50464:594613..594637 21/25 unknown
tropicalis 7.1 scaffold_10:28466940..28466964 24/25 Antisense target ywhab
scaffold_1004:11070..11094 21/25 Antisense off-target tesmin
scaffold_260:103009..103033 21/25 Antisense off-target sspo
scaffold_3b:3089169..3089193 21/25 unknown
scaffold_6:3537753..3537777 21/25 unknown
Publications
First: Differential role of 14-3-3 family members in Xenopus development. [Dev Dyn 2006]
Most recent: Analysis of 14-3-3 family member function in Xenopus embryos by microinjection of antisense morpholino oligos. [Methods Mol Biol 2009]
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.0
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556