Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250649

Morpholino Name: ywhae MO4
Synonyms: 14-3-3 epsilon
mRNA Target: ywhae

Morpholino Type: uncategorized morpholino
Sequence:
5' TACACTAAATCCTCTCGCTCTTCCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 24/25
genomic

MO
5' TGGAAGAGCGAGAGGATCTAGTGTA 3' ||||||||||||||||| ||||||| 3' ACCTTCTCGCTCTCCTAAATCACAT 5' 5' TGGAAGAGCGAGAGGATCTAGTGTA 3' ||||||||||||||||| ||||||| 3' ACCTTCTCGCTCTCCTAAATCACAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold112554:2012613..2012637 24/25 Antisense off-target Xelaev16003383m
Scaffold159212:1244202..1244226 24/25 Antisense target ywhae.S
Scaffold403228:988406..988430 21/25 unknown
tropicalis 7.1 scaffold_2:21636499..21636523 24/25 Antisense target ywhae
Publications
First: Differential role of 14-3-3 family members in Xenopus development., Dev Dyn 2006                                                      
Most recent: Analysis of 14-3-3 family member function in Xenopus embryos by microinjection of antisense morpholino oligos., Methods Mol Biol 2009  
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556