Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250650

Morpholino Name: ywhag MO1
Synonyms: 14-3-3 gamma
mRNA Target: ywhag

Morpholino Type: uncategorized morpholino
Sequence:
5' GCACCAGCTGCTCGCGGTCCACCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' ATGGTGGACCGCGAGCAGCTGGTGC 3' ||||||||||||||||||||||||| 3' TACCACCTGGCGCTCGTCGACCACG 5' 5' ATGGTGGACCGCGAGCAGCTGGTGC 3' ||||||||||||||||||||||||| 3' TACCACCTGGCGCTCGTCGACCACG 5' 5' ATGGTGGACCGCGAGCAGCTGGTGC 3' ||||||||||||||||||||||||| 3' TACCACCTGGCGCTCGTCGACCACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold267344:1662083..1662107 25/25 Antisense target ywhag.L
Scaffold67669:2776426..2776450 25/25 Antisense target ywhag.S
tropicalis 7.1 scaffold_2:21092145..21092169 25/25 Antisense target ywhag
scaffold_5:69157989..69158013 22/25 Antisense off-target tbce
Publications
First: Differential role of 14-3-3 family members in Xenopus development., Dev Dyn 2006                                                      
Most recent: Analysis of 14-3-3 family member function in Xenopus embryos by microinjection of antisense morpholino oligos., Methods Mol Biol 2009  
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.1


Major funding for Xenbase is provided by grant P41 HD064556