Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250651

Morpholino Name: ywhah MO1
Synonyms: 14-3-3eta, TGas138o08, Xt14-3-3eta
mRNA Target: ywhah

Morpholino Type:
Sequence:
5' CTGCTCCCGATCAGCCATCCTTTCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' TGAAAGGATGGCTGATCGGGAGCAG 3' ||||||||||||||||||||||||| 3' ACTTTCCTACCGACTAGCCCTCGTC 5' 5' CGAAAGGATGGCTGATCGGGAGCAG 3' |||||||||||||||||||||||| 3' ACTTTCCTACCGACTAGCCCTCGTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold394729:371452..371476 25/25 Antisense off-target Xelaev16050160m
Scaffold162663:1222517..1222541 24/25 Antisense target ywhah.L
tropicalis 7.1 scaffold_1:55748647..55748671 25/25 Antisense target ywhah
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.0
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556