Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250655

Morpholino Name: ywhaq MO2
Synonyms: 14-3-3theta, TTpA008p09, Xt14-3-3theta.2
mRNA Target: ywhaq

Morpholino Type:
Sequence:
5' CTGTGCTGAGGGAGGAAATCAGATA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' TATCTGATTTCCTCCCTCAGCACAG 3' ||||||||||||||||||||||||| 3' ATAGACTAAAGGAGGGAGTCGTGTC 5' 5' TATCTGATCTCCTCCCTCAGCACAG 3' |||||||| |||||||||||||||| 3' ATAGACTAAAGGAGGGAGTCGTGTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold142445:3097664-3097688 24/25 Antisense off-target Xelaev16012780m
Scaffold43061:7816784-7816808 24/25 Antisense target ywhaq.S
Scaffold19375:484935-484959 22/25 unknown
Scaffold145916:1123425-1123449 21/25 unknown
Scaffold61741:2437834-2437858 21/25 unknown
tropicalis 7.1 scaffold_5:26296582-26296606 25/25 Antisense target ywhaq
scaffold_17:439153-439177 22/25 unknown
scaffold_2:65408695-65408719 22/25 unknown
scaffold_2:95537463-95537487 22/25 Antisense off-target tpp2
scaffold_2:95537463-95537487 22/25 Sense off-target mettl21c
scaffold_1:104226330-104226354 21/25 unknown
scaffold_1:111252061-111252085 21/25 unknown
scaffold_1:157676126-157676150 21/25 unknown
scaffold_1:184239126-184239150 21/25 unknown
scaffold_1:34120869-34120893 21/25 unknown
scaffold_1:35443476-35443500 21/25 unknown
scaffold_1:63657313-63657337 21/25 Antisense off-target pole
scaffold_1:90709442-90709466 21/25 unknown
scaffold_1:96745634-96745658 21/25 unknown
scaffold_10:17408208-17408232 21/25 unknown
scaffold_2:118477607-118477631 21/25 Sense off-target cwf19l2
scaffold_2:133320418-133320442 21/25 unknown
scaffold_2:18423454-18423478 21/25 unknown
scaffold_2:20947047-20947071 21/25 unknown
scaffold_3:109485516-109485540 21/25 unknown
scaffold_3:45557334-45557358 21/25 unknown
scaffold_3:57305450-57305474 21/25 unknown
scaffold_3:73957075-73957099 21/25 Sense off-target nop16
scaffold_3:76931310-76931334 21/25 unknown
scaffold_4:111051016-111051040 21/25 unknown
scaffold_4:64836431-64836455 21/25 unknown
scaffold_4:92861054-92861078 21/25 Sense off-target lrrc7
scaffold_5:2558057-2558081 21/25 unknown
scaffold_5:3853273-3853297 21/25 unknown
scaffold_5:59005041-59005065 21/25 unknown
scaffold_5:89656137-89656161 21/25 unknown
scaffold_6:129324549-129324573 21/25 unknown
scaffold_6:129884050-129884074 21/25 unknown
scaffold_6:33236898-33236922 21/25 Sense off-target tox
scaffold_6:61672348-61672372 21/25 unknown
scaffold_6:82908700-82908724 21/25 unknown
scaffold_7:13174515-13174539 21/25 Sense off-target rtkn2
scaffold_7:21824777-21824801 21/25 unknown
scaffold_7:28172744-28172768 21/25 Sense off-target zfyve27
scaffold_7:44708629-44708653 21/25 unknown
scaffold_7:45675401-45675425 21/25 unknown
scaffold_7:49707842-49707866 21/25 unknown
scaffold_7:62906866-62906890 21/25 unknown
scaffold_7:86950468-86950492 21/25 unknown
scaffold_8:94394850-94394874 21/25 unknown
scaffold_9:38997365-38997389 21/25 unknown
scaffold_9:53925756-53925780 21/25 unknown
scaffold_9:72629954-72629978 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556