Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250655

Morpholino Name: ywhaq MO2
Synonyms: 14-3-3theta, TTpA008p09, Xt14-3-3theta.2
mRNA Target: ywhaq

Morpholino Type: uncategorized morpholino
Sequence:
5' CTGTGCTGAGGGAGGAAATCAGATA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25 24/25
genomic

MO
5' TATCTGATTTCCTCCCTCAGCACAG 3' ||||||||||||||||||||||||| 3' ATAGACTAAAGGAGGGAGTCGTGTC 5' 5' TATCTGACTTCCTCCCTCAGCACAG 3' ||||||| ||||||||||||||||| 3' ATAGACTAAAGGAGGGAGTCGTGTC 5' 5' TATCTGATCTCCTCCCTCAGCACAG 3' |||||||| |||||||||||||||| 3' ATAGACTAAAGGAGGGAGTCGTGTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:137707330..137707354 24/25 Antisense target ywhaq.L
chr5S:118715614..118715638 24/25 Antisense target ywhaq.S
chr8S:52661699..52661723 22/25 Antisense off-target gria3.S
chr1L:46082431..46082455 21/25 unknown
chr2L:5584610..5584634 21/25 unknown
tropicalis 10.0 Chr5:137895411..137895435 25/25 Antisense target ywhaq
Chr2:119666667..119666691 22/25 Sense off-target mettl21c
Chr2:120999441..120999465 22/25 Sense off-target clybl
Chr5:156454220..156454244 22/25 unknown
Chr1:109632066..109632090 21/25 unknown
Chr1:122343235..122343259 21/25 unknown
Chr1:128295269..128295293 21/25 Sense off-target smarca2
Chr1:134998646..134998670 21/25 unknown
Chr1:144182838..144182862 21/25 Antisense off-target pole
Chr1:167814616..167814640 21/25 Antisense off-target slc12a2
Chr1:172496381..172496405 21/25 unknown
Chr1:39591587..39591611 21/25 Antisense off-target Xetrov107001166m.g
Chr1:64436400..64436424 21/25 unknown
Chr10:22953670..22953694 21/25 Sense off-target rbfox3
Chr2:160241753..160241777 21/25 Sense off-target cwf19l2
Chr4:76609103..76609127 21/25 Antisense off-target ano10l
Chr4:82887484..82887508 21/25 Sense off-target lrrc7
Chr5:106026060..106026084 21/25 Sense off-target ahsg
Chr5:121767841..121767865 21/25 unknown
Chr5:37340067..37340091 21/25 unknown
Chr5:66273117..66273141 21/25 unknown
Chr6:116528746..116528770 21/25 Sense off-target tox
Chr6:16550948..16550972 21/25 unknown
Chr6:17125759..17125783 21/25 unknown
Chr6:60485527..60485551 21/25 unknown
Chr6:88044987..88045011 21/25 unknown
Chr2:167875539..167875563 21/25 Sense off-target grm5
Chr2:34965043..34965067 21/25 Sense off-target sebox
Chr2:94151753..94151777 21/25 Sense off-target srrm3
Chr3:35282003..35282027 21/25 unknown
Chr3:45501214..45501238 21/25 Sense off-target nop16
Chr3:48149306..48149330 21/25 Antisense off-target reep2
Chr3:81044033..81044057 21/25 Sense off-target grm3
Chr7:27222437..27222461 21/25 Sense off-target adgra1
Chr7:33762041..33762065 21/25 Sense off-target zfyve27
Chr7:46419022..46419046 21/25 Antisense off-target cdh23
Chr7:52816141..52816165 21/25 Antisense off-target parg
Chr7:71236648..71236672 21/25 Sense off-target kirrel3
Chr7:72733823..72733847 21/25 Sense off-target arhgap32
Chr8:119438745..119438769 21/25 Antisense off-target gphn
Chr9:27109929..27109953 21/25 unknown
Chr9:50314798..50314822 21/25 Antisense off-target LOC105948355
Chr7:17527870..17527894 21/25 Antisense off-target arid5b
Chr7:17679366..17679390 21/25 Sense off-target rtkn2
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers