Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250662

Morpholino Name: zak MO1
Synonyms: xMLTK MO
mRNA Target: map3k20

Morpholino Type:
Sequence:
5' ACGAAGCCGTTAAGGACAACATCTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' GAGATGTTGTCCTTAACTGCTTCGT 3' ||||||||||||||||| ||||||| 3' CTCTACAACAGGAATTGCCGAAGCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold43242:5618166-5618190 25/25 Antisense off-target Xelaev16053436m
Scaffold4321:6646150-6646174 24/25 Antisense off-target Xelaev16053067m
tropicalis 7.1 scaffold_9:18965654-18965678 24/25 Antisense target map3k20
Publications
First: The protein kinase MLTK regulates chondrogenesis by inducing the transcription factor Sox6. [Development 2012]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556