Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250662

Morpholino Name: map3k20 MO1
Synonyms: xMLTK MO, xMLTK-MO, zak MO1
Target mRNA: map3k20

Morpholino Type: uncategorized morpholino
Sequence: 5' ACGAAGCCGTTAAGGACAACATCTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 24/25
genomic

MO
5' GAGATGTTGTCCTTAACTGCTTCGT 3' ||||||||||||||||| ||||||| 3' CTCTACAACAGGAATTGCCGAAGCA 5' 5' GAGATGTTGTCCTTAACGGCTTCGT 3' ||||||||||||||||||||||||| 3' CTCTACAACAGGAATTGCCGAAGCA 5' 5' GAGATGTTGTCCTTAACTGCTTCGT 3' ||||||||||||||||| ||||||| 3' CTCTACAACAGGAATTGCCGAAGCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10L:66242168..66242192 25/25 Antisense target map3k20.L
chr9_10S:60568364..60568388 24/25 Antisense target map3k20.S
tropicalis 10.0 Chr9:66948152..66948176 24/25 Antisense target map3k20
Publications
First: The protein kinase MLTK regulates chondrogenesis by inducing the transcription factor Sox6., Development 2012                          
Most recent: Adaptive correction of craniofacial defects in pre-metamorphic Xenopus laevis tadpoles involves thyroid hormone-independent tissue remodeling., Development 2019                                
View All Papers