Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250663

Morpholino Name: zbtb33 MO1
Synonyms: Kaiso, xKaiso MO, xKaiso MOtss, xKaiso morpholino oligo
mRNA Target: zbtb33

Morpholino Type:
Sequence:
5' GATCAGCTTTTTTGTCTCCATGTCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 25/25
genomic

MO
5' AGACATGGAGACAAAAAAACTCATA 3' |||||||||||||||||| || || 3' TCTGTACCTCTGTTTTTTCGACTAG 5' 5' AGACATGGAGACAAAAAAGCTGATC 3' ||||||||||||||||||||||||| 3' TCTGTACCTCTGTTTTTTCGACTAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold86967:4343323-4343347 25/25 Antisense target zbtb33.S
Scaffold7546:104175-104199 24/25 Antisense off-target Xelaev16072222m
Scaffold14557:3673747-3673771 22/25 unknown
Scaffold23403:14138801-14138825 21/25 Antisense off-target c16orf62.S
Scaffold247724:1723119-1723143 21/25 unknown
Scaffold265107:2237713-2237737 21/25 Antisense off-target Xelaev16035695m
Scaffold43791:4306391-4306415 21/25 unknown
Scaffold9994:5474261-5474285 21/25 Antisense off-target Xelaev16081393m
tropicalis 7.1 scaffold_7:5735297-5735321 22/25 Antisense target zbtb33
scaffold_4:33587347-33587371 21/25 unknown
scaffold_9:69128156-69128180 21/25 Antisense off-target c16orf62
Publications
First: Kaiso is a genome-wide repressor of transcription that is essential for amphibian development. [Development 2004]
Most recent: Xenopus delta-catenin is essential in early embryogenesis and is functionally linked to cadherins and small GTPases. [J Cell Sci 2009]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556