Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250664

Morpholino Name: zc3h3 MO1
Synonyms: XtMO1, xt smicl
mRNA Target: zc3h3

Morpholino Type:
Sequence:
5' TGCAGCGCCTCTCTCTCCTCCATGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ACATGGAGGAGAGAGAGGCGCTGCA 3' ||||||||||||||||||||||||| 3' TGTACCTCCTCTCTCTCCGCGACGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold184854:102853-102877 21/25 unknown
Scaffold276272:305423-305447 21/25 unknown
Scaffold46073:2733190-2733214 21/25 Sense off-target fbxw5.S
tropicalis 7.1 scaffold_71:194251-194275 25/25 Antisense target zc3h3
scaffold_2:142542176-142542200 21/25 unknown
scaffold_7:116012418-116012442 21/25 unknown
Publications
First: The novel Smad-interacting protein Smicl regulates Chordin expression in the Xenopus embryo. [Development 2005]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556