Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250666

Morpholino Name: zc3h3 MO3
Synonyms: Smicl MO, XlMO, xl smicl
mRNA Target: zc3h3

Morpholino Type:
Sequence:
5' AGCGCCTCCTTCTCCTCCGCCATAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold135348:668703-668727 25/25 Antisense off-target Xelaev16010553m
Scaffold102974:1986431-1986455 21/25 unknown
Scaffold117539:250921-250945 21/25 unknown
Scaffold309483:660-684 21/25 unknown
Scaffold4321:8336688-8336712 21/25 unknown
Publications
First: The novel Smad-interacting protein Smicl regulates Chordin expression in the Xenopus embryo. [Development 2005]
Most recent: Smicl is required for phosphorylation of RNA polymerase II and affects 3''-end processing of RNA at the midblastula transition in Xenopus. [Development 2009]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556