Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250667

Morpholino Name: zeb2 MO1
Synonyms: SIP1MO, XSIP1 MO, sip1
mRNA Target: zeb2

Morpholino Type:
Sequence:
5' CTTGCTTCATTGATAAGAGTGGGAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold4321:15894681..15894705 25/25 Antisense off-target Xelaev16053255m
Scaffold21603:7548920..7548944 24/25 unknown
tropicalis 7.1 scaffold_9:7483133..7483157 25/25 unknown
scaffold_2:518105..518129 21/25 unknown
scaffold_36:547427..547451 21/25 unknown
Publications
First: XSIP1 is essential for early neural gene expression and neural differentiation by suppression of BMP signaling. [Dev Biol 2004]
Most recent: Geminin cooperates with Polycomb to restrain multi-lineage commitment in the early embryo. [Development 2011]
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556