Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250669

Morpholino Name: zfand6 MO2
Synonyms: XAWP1 MO1
mRNA Target: zfand6

Morpholino Type:
Sequence:
5' TTTGTCTCCTGCGCCATAATCATCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' GCATGATTATGGCGCAAGAGACAAA 3' | |||||||||||||| |||||||| 3' CCTACTAATACCGCGTCCTCTGTTT 5' 5' GGATGATTATGGCGCAGGAGACAAA 3' ||||||||||||||||||||||||| 3' CCTACTAATACCGCGTCCTCTGTTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold36401:2448509-2448533 25/25 Antisense target zfand6.S
Scaffold58049:6276626-6276650 25/25 Antisense off-target Xelaev16063854m
tropicalis 7.1 scaffold_3:16780635-16780659 23/25 Antisense target zfand6
Publications
First: Essential role of AWP1 in neural crest specification in Xenopus. [Int J Dev Biol 2013]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556