Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250670

Morpholino Name: zfp36 MO1
Synonyms: MOzfp36
mRNA Target: zfp36

Morpholino Type: uncategorized morpholino
Sequence:
5' ATATCCAGGATAGAGGACATATTGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genomic

MO
5' TCAGTATGTCCTCTATCCTGGATAT 3' ||| ||||||||||||||||||||| 3' AGTTATACAGGAGATAGGACCTATA 5' 5' TCAATATGTCCTCTATCCTGGATAT 3' ||||||||||||||||||||||||| 3' AGTTATACAGGAGATAGGACCTATA 5' 5' TCAATATGTCCTCTATCCTGGATAT 3' ||||||||||||||||||||||||| 3' AGTTATACAGGAGATAGGACCTATA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:59192541..59192565 25/25 Antisense target zfp36.L
chr8S:84640232..84640256 25/25 Antisense target zfp36.S
chr1L:132461789..132461813 21/25 Sense off-target slc28a3.L
chr1S:109406177..109406201 21/25 Sense off-target LOC108706988
chr6S:41148055..41148079 21/25 unknown
chr8L:63130527..63130551 21/25 unknown
tropicalis 10.0 Chr8:81495893..81495917 24/25 Antisense target zfp36
Publications
First: Comparative Functional Analysis of ZFP36 Genes during Xenopus Development., PLoS One 2013                            
Most recent:
View All Papers