Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250670

Morpholino Name: zfp36 MO1
Synonyms: MOzfp36
mRNA Target: zfp36

Morpholino Type: uncategorized morpholino
Sequence:
5' ATATCCAGGATAGAGGACATATTGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' TCAGTATGTCCTCTATCCTGGATAT 3' ||| ||||||||||||||||||||| 3' AGTTATACAGGAGATAGGACCTATA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold50079:4487263..4487287 25/25 Antisense off-target Xelaev16058225m
Scaffold13576:291184..291208 21/25 Sense off-target Xelaev16010738m
Scaffold39723:3454721..3454745 21/25 unknown
Scaffold69258:200742..200766 21/25 unknown
Scaffold86871:2221634..2221658 21/25 unknown
tropicalis 7.1 scaffold_8:55374138..55374162 24/25 Antisense target zfp36
Publications
First: Comparative Functional Analysis of ZFP36 Genes during Xenopus Development., PLoS One 2013                            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556