Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250671

Morpholino Name: zfp36l1 MO1
Synonyms: MOzfp36l1
mRNA Target: zfp36l1

Morpholino Type: uncategorized morpholino
Sequence:
5' AGGAGAAATCAATGCTGTAGACATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25 24/25
genomic

MO
5' GATGTCTACAGCATTGATTTCTCCT 3' ||||||||||||||||||||||||| 3' CTACAGATGTCGTAACTAAAGAGGA 5' 5' GATGTCTACAGCATTGATTTCTCCT 3' ||||||||||||||||||||||||| 3' CTACAGATGTCGTAACTAAAGAGGA 5' 5' GATGTCTACAGCTTTGATTTCTCCT 3' |||||||||||| |||||||||||| 3' CTACAGATGTCGTAACTAAAGAGGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold218195:962890..962914 25/25 Antisense target zfp36l1.L
Scaffold185046:277..301 24/25 unknown
Scaffold90886:137278..137302 24/25 Antisense target zfp36l1.S
Scaffold67669:2614816..2614840 22/25 unknown
Scaffold25254:387061..387085 21/25 unknown
Scaffold56777:3528795..3528819 21/25 Sense off-target kdelr1.S
tropicalis 7.1 scaffold_8:96720263..96720287 25/25 Antisense target zfp36l1
Publications
First: Comparative Functional Analysis of ZFP36 Genes during Xenopus Development., PLoS One 2013                            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556