Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250672

Morpholino Name: zfp36l2 MO1
Synonyms: MOzfp36l2, XC3MO
mRNA Target: zfp36l2

Morpholino Type: uncategorized morpholino
Sequence:
5' CGGATAAAAGGGTCGTAGACATTTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25 24/25
genomic

MO
5' GAAATGTCTACGACCCTTTTATCCG 3' ||||||||||||||||||||||||| 3' CTTTACAGATGCTGGGAAAATAGGC 5' 5' GAAATGTCTACGACCCTTTTATCCG 3' ||||||||||||||||||||||||| 3' CTTTACAGATGCTGGGAAAATAGGC 5' 5' GAAATGTCTGCGACCCTTTTATCCG 3' ||||||||| ||||||||||||||| 3' CTTTACAGATGCTGGGAAAATAGGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold102974:14420452..14420476 25/25 Antisense target zfp36l2.L
Scaffold27036:1572531..1572555 24/25 Antisense target zfp36l2.S
tropicalis 7.1 scaffold_5:109842410..109842434 25/25 Antisense target zfp36l2
Publications
First: The isolation and characterization of XC3H-3b: a CCCH zinc-finger protein required for pronephros development., Biochem Biophys Res Commun 2003          
Most recent: Comparative Functional Analysis of ZFP36 Genes during Xenopus Development., PLoS One 2013                            
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556