Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250673

Morpholino Name: zfpm1 MO1
Synonyms: FOG MO2, xFOGa
mRNA Target: zfpm1

Morpholino Type: uncategorized morpholino
Sequence:
5' ATTGCTCTGTTTCCTTCTGGACATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold5765:1520198..1520222 25/25 Antisense off-target Xelaev16063447m
Scaffold133669:1371267..1371291 21/25 unknown
Scaffold142445:2222309..2222333 21/25 unknown
Scaffold2049:1048958..1048982 21/25 unknown
Scaffold36864:1438914..1438938 21/25 Antisense off-target Xelaev16047882m
Scaffold99286:5906729..5906753 21/25 Sense off-target Xelaev16081124m
tropicalis 7.1 scaffold_4:50379142..50379166 24/25 unknown
scaffold_7:45257476..45257500 22/25 unknown
scaffold_4:32841266..32841290 21/25 unknown
scaffold_5:30836621..30836645 21/25 Antisense off-target uggt1
scaffold_9:23389542..23389566 21/25 unknown
scaffold_9:71255646..71255670 21/25 Sense off-target ints1
Publications
First: Friend of GATA (FOG) interacts with the nucleosome remodeling and deacetylase complex (NuRD) to support primitive erythropoiesis in Xenopus laevis., PLoS One 2012            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556