Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250674

Morpholino Name: zfpm1 MO2
Synonyms: xFOGb, zfpm1
mRNA Target: zfpm1

Morpholino Type: uncategorized morpholino
Sequence:
5' GCTGGAGGACAAGGCAGGATCAAGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GCTTGATCCTGCCTTGTCCTCCAGC 3' ||||||||||||||||||||||||| 3' CGAACTAGGACGGAACAGGAGGTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold98999:668941..668965 25/25 Antisense target zfpm1.L
Scaffold47509:1011713..1011737 21/25 unknown
Scaffold5370:1390935..1390959 21/25 unknown
Publications
First: Friend of GATA (FOG) interacts with the nucleosome remodeling and deacetylase complex (NuRD) to support primitive erythropoiesis in Xenopus laevis., PLoS One 2012            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556