Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250675

Morpholino Name: zic1 MO1
Synonyms: Zic1, Zic1 MO, Zic1-MO, Zic1MO
mRNA Target: zic1

Morpholino Type: uncategorized morpholino
Sequence:
5' AAGTCTTCCAACAATGGGCAGCGAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' TTTGCTGCCGATTGTTGGAAGACTT 3' || |||||| ||||||||||||||| 3' AAGCGACGGGTAACAACCTTCTGAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold130324:1769736..1769760 25/25 Antisense off-target Xelaev16008683m
Scaffold82102:7193930..7193954 25/25 Antisense off-target Xelaev16075208m
tropicalis 7.1 scaffold_5:2328826..2328850 23/25 Antisense target zic1
scaffold_7:400363..400387 21/25 unknown
Publications
First: A Meis family protein caudalizes neural cell fates in Xenopus., Mech Dev 1999            
Most recent: A gene regulatory network underlying the formation of pre-placodal ectoderm in Xenopus laevis., BMC Biol 2018                              
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556