Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250675

Morpholino Name: zic1 MO1
Synonyms: Zic1, Zic1 MO, Zic1-MO, Zic1MO
Target mRNA: zic1

Morpholino Type: uncategorized morpholino
Sequence: 5' AAGTCTTCCAACAATGGGCAGCGAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' TTCGCTGCCCATTGTTGGAAGACTT 3' ||||||||||||||||||||||||| 3' AAGCGACGGGTAACAACCTTCTGAA 5' 5' TTCGCTGCCCATTGTTGGAAGACTT 3' ||||||||||||||||||||||||| 3' AAGCGACGGGTAACAACCTTCTGAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:119254506..119254530 25/25 Antisense target zic1.L
chr5S:102483662..102483686 25/25 Antisense target zic1.S
tropicalis 10.0 Chr5:121536563..121536587 23/25 Antisense off-target LOC100493456
Publications
First: A Meis family protein caudalizes neural cell fates in Xenopus., Mech Dev 1999            
Most recent: Retinoic acid production, regulation, and containment through Zic1, Pitx2c and Cyp26c1 control cranial placode specification., Development 2021  
View All Papers