Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250683

Morpholino Name: znf462 MO1
Synonyms: MO2 xZFPIP
mRNA Target: znf462

Morpholino Type: uncategorized morpholino
Sequence:
5' TTCCTAAACCAGGATTTTCATTAGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' CCTAATGAAAAGCCTGCTTTAGGAA 3' ||||||||||| |||| |||||||| 3' GGATTACTTTTAGGACCAAATCCTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold90041:182302..182326 25/25 Antisense off-target Xelaev16077931m
Scaffold17434:5219223..5219247 23/25 Sense off-target Xelaev16020910m
Scaffold61609:2579294..2579318 23/25 Antisense target znf462.S
Scaffold12933:616882..616906 21/25 unknown
Scaffold155082:349402..349426 21/25 Sense off-target Xelaev16016167m
Scaffold187321:749255..749279 21/25 unknown
Scaffold34527:1330500..1330524 21/25 unknown
Scaffold52018:2195..2219 21/25 unknown
Scaffold8355:2326439..2326463 21/25 Sense off-target Xelaev16075518m
tropicalis 7.1 scaffold_4:101145288..101145312 21/25 Sense off-target slc6a9
Publications
First: ZFPIP/Zfp462 is maternally required for proper early Xenopus laevis development., Dev Biol 2009        
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556